After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CXCL8 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000584.2
Tamaño de cDNA:300bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens interleukin 8 with N terminal His tag.
Sinónimo de gen:CXCL8, GCP-1, GCP1, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP-1, NAP1
Especie:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-IL8
Sitio de restricción:KpnI + XbaI (6kb + 0.33kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CXCL8 Gene Plasmid Map
Human interleukin 8 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10098-ACG$225
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10098-ACR$225
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10098-CF$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10098-CH$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10098-CM$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10098-CY$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(Vector de expresión)HG10098-M$75
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10098-NF$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10098-NH$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10098-NM$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10098-NY$195
Humano IL-8/Interleukin-8/CXCL8 clonación del ADN o clonación génica(vector de clonación)HG10098-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was initially characterized for its leukocyte chemotactic activity, is now known to possess tumorigenic and proangiogenic properties as well. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli (IL1, TNF, LPS, etc). In human gliomas, IL-8 is expressed and secreted at high levels both in vitro and in vivo, and recent experiments suggest it is critical to glial tumor neovascularity and progression. Levels of IL-8 correlate with histologic grade in glial neoplasms, and the most malignant form, glioblastoma, shows the highest expression in pseudopalisading cells around necrosis, suggesting that hypoxia/anoxia may stimulate expression. Interleukin (IL)-8/CXCL8 is a potent neutrophil chemotactic factor. Accumulating evidence has demonstrated that various types of cells can produce a large amount of IL-8/CXCL8 in response to a wide variety of stimuli, including proinflammatory cytokines, microbes and their products, and environmental changes such as hypoxia, reperfusion, and hyperoxia. Numerous observations have established IL-8/CXCL8 as a key mediator in neutrophil-mediated acute inflammation due to its potent actions on neutrophils. However, several lines of evidence indicate that IL-8/CXCL8 has a wide range of actions on various types of cells, including lymphocytes, monocytes, endothelial cells, and fibroblasts, besides neutrophils. The discovery of these biological functions suggests that IL-8/CXCL8 has crucial roles in various pathological conditions such as chronic inflammation and cancer. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.

Referencias
  • Mukaida N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol. 284(4): L566-77.
  • Brat DJ, et al. (2005) The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33.
  • Bendrik C, et al. (2009) Estradiol increases IL-8 secretion of normal human breast tissue and breast cancer in vivo. J Immunol. 182(1): 371-8.
  • Size / Price
    Catálogo: HG10098-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human interleukin 8 ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"