After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human NRG1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_013957.3
Tamaño de cDNA:1914bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens neuregulin 1 transcript variant HRG-beta2.
Sinónimo de gen:GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10658-ACG$245
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10658-ACR$245
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10658-CF$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10658-CH$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10658-CM$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10658-CY$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(Vector de expresión)HG10658-M$75
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10658-NF$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10658-NH$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10658-NM$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10658-NY$215
Humano NRG1/Neuregulin 1 transcript variant HRG-beta2 clonación del ADN o clonación génica(vector de clonación)HG10658-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis. 

Referencias
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.
  • Size / Price
    Catálogo: HG10658-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"