After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
RSV RSV-F Información de producto de clon de cDNA
Gene_bank_ref_id:
Tamaño de cDNA:1725bp
Descripción de cDNA:Full length Clone DNA of Human RSV (subtype A, strain Long) Fusion glycoprotein / RSV-F with C terminal HA tag.
Sinónimo de gen:F, HRSVgp08
Especie:RSV
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P12568.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta on other vectors
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40039-ACG$345
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40039-ACR$345
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG40039-CF$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG40039-CH$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG40039-CM$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG40039-CY$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40039-G$115
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG40039-NF$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG40039-NH$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40039-NM$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG40039-NY$315
Humano respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40039-UT$315
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

Referencias
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Catálogo: VG40039-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"