Pedido rápido

Text Size:AAA

Humano SFRP2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SFRP2 Información de producto de clon de cDNA
Tamaño de cDNA:888bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens secreted frizzled-related protein 2 with N terminal His tag.
Sinónimo de gen:FRP-2, SARP1, SDF-5, SFRP2
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

The Secreted frizzled-related protein (SFRP) family consists of five secreted glycoproteins in humans (SFRP1~5) that act as extracellular signaling ligands. Each SFRP is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. sFRP2 is a member of the SFRP family acting as soluble modulators of Wnt signaling and contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins called FZ domain and a NTR domain.sFRP2 inhibites hypoxia induced endothelial cell apoptosis and increases endothelial cell migration. It prevents mesoderm specification and maintains the cells in the undifferentiated state. SFRP2 is also a novel stimulator of angiogenesis that stimulates angiogenesis via a calcineurin/NFAT pathway, thus is regarded as a favorable target for the inhibition of angiogenesis in solid tumors. Mouse sFRP2 is highly expressed in the eye and is also detected in heart and lung at low level.

Size / Price
Catálogo: HG10756-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.