Pedido rápido

Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano PLAT Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_000930.3
    Tamaño de cDNA:1689bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens plasminogen activator, tissue (PLAT), transcript variant 1 with N terminal Myc tag.
    Sinónimo de gen:PLAT, TPA, T-PA, DKFZp686I03148
    Especie:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLAT qPCR primers for gene expression analysis, HP100227 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10157-ACG$245
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10157-ACR$245
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10157-CF$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10157-CH$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10157-CM$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10157-CY$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10157-M$75
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10157-M-F$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10157-NF$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10157-NH$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10157-NM$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10157-NY$215
    Humano tPA transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10157-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Tissue plasminogen activator (abbreviated tPA or PLAT), is traditionally viewed as a simple serine protease whose main function is to convert plasminogen into biologically active plasmin. As a protease, tPA plays a crucial role in regulating blood fibrinolysis, in maintaining the homeostasis of extracellular matrix and in modulating the post-translational activation of growth factors. tPA is synthesized and secreted as a single chain polypeptide precursor which is cleaved in turn by plasmin. Proteolytic cleavage at the C-terminal side of Arg275 generates the enzyme composed of two subunits, designated as α and β chains which are held together by a single disulfide bond. Unlike the other members of the chymotrypsin family, tPA has one particular distinction in that the catalytic efficiency of the single-chain enzyme is only slightly lower than that of the proteolytically cleaved form and is therefore not a true zymogen. tPA is found not only in the blood, where its primary function is as a thrombolytic enzyme, but also in the central nervous system (CNS). It participats in a number of physiological and pathological events in the CNS, as well as the role of neuroserpin as the natural regulator of tPA's activity in these processes. Increased or decreased activity of tPA leads to hyperfibrinolysis or hypofibrinolysis, respectively. In addition, as a cytokine, tPA plays a pivotal role in the pathogenesis of renal interstitial fibrosis through diverse mechanisms. Thus, as a fibrogenic cytokine, it promotes the progression of kidney diseases.

    Referencias
  • Yepes M, et al. (2004) New functions for an old enzyme: nonhemostatic roles for tissue-type plasminogen activator in the central nervous system. Exp Biol Med (Maywood). 229(11): 1097-104.
  • Samson AL, et al. (2006) Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron. 50(5): 673-8.
  • Skrzypiec AE, et al. (2008) Tissue plasminogen activator in the amygdala: a new role for an old protease. J Physiol Pharmacol. 59 Suppl 8: 135-46.
  • Hu K, et al. (2008) Novel actions of tissue-type plasminogen activator in chronic kidney disease. Front Biosci. 13: 5174-86.
  • Size / Price
    Catálogo: HG10157-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"