Pedido rápido

Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    H13N8 HA Información de producto de clon de cDNA
    Gene_bank_ref_id:
    Tamaño de cDNA:1698bp
    Descripción de cDNA:Full length Clone DNA of Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) HA with N terminal His tag.
    Sinónimo de gen:HA1, Hemagglutinin
    Especie:H13N8
    Vector:pCMV3-SP-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAV91212.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11721-ACG$345
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG11721-ACR$345
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11721-C$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG11721-CF$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG11721-CH$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG11721-CM$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG11721-CY$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG11721-NF$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG11721-NH$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11721-NM$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG11721-NY$315
    Gripe A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11721-UT$315
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

    Referencias
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catálogo: VG11721-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"