After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
H1N1 NS1 Información de producto de clon de cDNA
Gene_bank_ref_id:AF389122.1
Tamaño de cDNA:693bp
Descripción de cDNA:Full length Clone DNA of Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 with N terminal His tag.
Sinónimo de gen:NS1
Especie:H1N1
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40011-ACG$325
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40011-ACR$325
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40011-ANG$325
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40011-ANR$325
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-Flag EtiquetaVG40011-CF$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-His EtiquetaVG40011-CH$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-Myc EtiquetaVG40011-CM$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-HA EtiquetaVG40011-CY$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 natural ORF mammalian expression plasmidVG40011-M$95
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, His EtiquetaVG40011-M-H$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Flag EtiquetaVG40011-NF$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His EtiquetaVG40011-NH$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Myc EtiquetaVG40011-NM$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-HA EtiquetaVG40011-NY$295
Gripe A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 natural ORF mammalian expression plasmidVG40011-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The NS1 Influenza protein is created by the internal protein encoding, linear negative-sense, single stranded RNA, NS gene segment and which also codes for the nuclear export protein or NEP, formerly referred to as the NS2 protein, which mediates the export of vRNPs. The non-structural (NS1) protein is found in Influenza virus A, Influenza virus B and Influenza virus C. The non-structural (NS1) protein of the highly pathogenic avian H5N1 viruses circulating in poultry and waterfowl in Southeast Asia is currently believed to be responsible for the enhanced virulence of the strain. Non-structural (NS1) protein of influenza A viruses is a non-essential virulence factor that has multiple accessory functions during viral infection. The major role ascribed to NS1 has been its inhibition of host immune responses, especially the limitation of both interferon (IFN) production and the antiviral effects of IFN-induced proteins, such as dsRNA-dependent protein kinase R (PKR) and 2'5'-oligoadenylate synthetase (OAS)/RNase L. Non-structural (NS1) protein is a non-structural protein of the influenza A virus, which could only be expressed when cells are infected. The effect of NS1 protein on host cell is still not clear. Not only could NS1 remarkably affect metabolism, but it could also slow down cell proliferation through blocking cell cycle. Non-structural (NS1) protein may lead to the development of novel antiviral drugs, and the use of oncolytic influenza A viruses as potential anti-cancer agents.

Referencias
  • Enami,M. et al., 1997, Nippon Rinsho. 55 (10):2605-9.
  • Bergmann,M. et al., 2000, J Virol. 74 (13):6203-6.
  • Hale,B.G. et al., 2008, J Gen Virol. 89 (Pt 10):2359-76.
  • Zhao,L. et al., 2008, Sheng Wu Gong Cheng Xue Bao. 24 (11):1912-7
  • Size / Price
    Catálogo: VG40011-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"