Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

1/1
Price:
Size:
Number:

Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag: General Information

Gene
Species
H3N2
RefSeq ORF Size
1452 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACN50232.1.
Description
Full length Clone DNA of Influenza A H3N2 (A/Babol/36/2005) Neuraminidase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.45kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Neuraminidase / NA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag: Validated Images

Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag: Alternative Names

NA cDNA ORF Clone, H3N2

Neuraminidase / NA Background Information

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell. Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins. Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell. Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection. Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.
References
  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.

Neuraminidase / NA cDNA ORF Clone, H1N1, Related Products

Neuraminidase / NA cDNA ORF Clone, H3N2, Related Products

Neuraminidase / NA cDNA ORF Clone, H9N2, Related Products

Neuraminidase / NA cDNA ORF Clone, H5N1, Related Products

Neuraminidase / NA cDNA ORF Clone, H7N9, Related Products

Neuraminidase / NA cDNA ORF Clone, H3N8, Related Products

Neuraminidase / NA cDNA ORF Clone, H10N8, Related Products

Neuraminidase / NA cDNA ORF Clone, H12N5, Related Products

Neuraminidase / NA cDNA ORF Clone, H5N3, Related Products

Neuraminidase / NA cDNA ORF Clone, H4N6, Related Products

Neuraminidase / NA cDNA ORF Clone, H4N4, Related Products

Neuraminidase / NA cDNA ORF Clone, H5N8, Related Products

Add to Cart Successfully Add to Cart Failed