Pedido rápido

Text Size:AAA

Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
H3N8 NA Información de producto de clon de cDNA
Tamaño de cDNA:1413bp
Descripción de cDNA:Full length Clone DNA of Influenza A H3N8 (A/canine/NewYork/145353/2008) Neuraminidase with N terminal His tag.
Sinónimo de gen:Neuraminidase, NA
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Gripe A H3N8 (A/canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40233-ACG$325
Gripe A H3N8 (A/canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40233-ACR$325
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, C-Flag EtiquetaVG40233-CF$295
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, C-His EtiquetaVG40233-CH$295
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, C-Myc EtiquetaVG40233-CM$295
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, C-HA EtiquetaVG40233-CY$295
Gripe A H3N8 (A/canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid (Codon Optimized)VG40233-G$95
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, N-Flag EtiquetaVG40233-NF$295
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, N-His EtiquetaVG40233-NH$295
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, N-Myc EtiquetaVG40233-NM$295
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) ORF mammalian expression plasmid, N-HA EtiquetaVG40233-NY$295
Gripe A H3N8 (canine/New York/145353/2008) Neuraminidasa (NA) natural ORF mammalian expression plasmidVG40233-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Size / Price
    Catálogo: VG40233-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.