After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
H4N8 HA Información de producto de clon de cDNA
Tamaño de cDNA:1695bp
Descripción de cDNA:Full length Clone DNA of Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin with C terminal HA tag.
Sinónimo de gen:Hemagglutinin, HA
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P19695.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Etiqueta on other vectors
Gripe A H4N8 (A/chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40025-ACG$345
Gripe A H4N8 (A/chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40025-ACR$345
Gripe A H4N8 (A/chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized)VG40025-C$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG40025-CF$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG40025-CH$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG40025-CM$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG40025-CY$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG40025-NF$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG40025-NH$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40025-NM$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG40025-NY$315
Gripe A H4N8 (chicken/Alabama/1/1975) Hemaglutinina(HA) ORF mammalian expression plasmid (Codon Optimized)VG40025-UT$315
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40025-CY
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.