Pedido rápido

Text Size:AAA

Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready

Hoja de datosReseñasProductos relacionadosProtocolos
H5N1 HA Información de producto de clon de cDNA
Tamaño de cDNA:1701bp
Descripción de cDNA:Full length Clone DNA of Influenza A H5N1 (A/Xinjiang/1/2006) HA with N terminal His tag.
Sinónimo de gen:HA1, Hemagglutinin
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACJ68614.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready on other vectors
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression readyVG40004-ACG$345
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40004-ACR$345
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmidVG40004-C$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression readyVG40004-CF$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-His tag, expression readyVG40004-CH$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression readyVG40004-CM$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-HA tag, expression readyVG40004-CY$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Flag tag, expression readyVG40004-NF$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression readyVG40004-NH$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Myc tag, expression readyVG40004-NM$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression readyVG40004-NY$315
Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40004-UT$315
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40004-NH
Precio de lista:   (Save )
Precio:      [How to order]
Disponibilidad2-3 weeksInstrucciones de envío
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.