After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
H5N8 HA Información de producto de clon de cDNA
Gene_bank_ref_id:
Tamaño de cDNA:1717bp
Descripción de cDNA:Full length Clone DNA of Influenza A H5N8 (A/duck/NY/191255-59/02) HA with N terminal His tag.
Sinónimo de gen:HA1, Hemagglutinin
Especie:H5N8
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-H5N8-DN-02-HA
Sitio de restricción:KpnI + XbaI (6kb + 1.74kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAP72011.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
H5N8 HA Gene Plasmid Map
Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11717-ACG$345
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG11717-ACR$345
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11717-C$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG11717-CF$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG11717-CH$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG11717-CM$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG11717-CY$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG11717-NF$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG11717-NH$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11717-NM$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG11717-NY$315
Gripe A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11717-UT$315
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Referencias
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catálogo: VG11717-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Influenza A H5N8 (A/duck/NY/191255-59/02) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"