Pedido rápido

Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

Hoja de datosReseñasProductos relacionadosProtocolos
H9N2 HA Información de producto de clon de cDNA
Tamaño de cDNA:1683bp
Descripción de cDNA:Full length Clone DNA of Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin with C terminal HA tag.
Sinónimo de gen:Hemagglutinin, HA
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ADC41863.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag on other vectors
Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40178-ACG$345
Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40178-ACR$345
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40178-CF$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40178-CH$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40178-CM$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40178-CY$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40178-NF$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40178-NH$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40178-NM$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40178-NY$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40178-UT$315
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40178-CY
Precio de lista:   (Save )
Precio:      [How to order]
Disponibilidad2-3 weeks
 Instrucciones de envío
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.