Pedido rápido

Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Influenza B HA Información de producto de clon de cDNA
Tamaño de cDNA:1758bp
Descripción de cDNA:Full length Clone DNA of Influenza B (B/Malaysia/2506/2004) HA with N terminal His tag.
Sinónimo de gen:HA1, Hemagglutinin
Especie:Influenza B
Sitio de restricción:KpnI + XbaI (6kb + 1.80kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACO05957.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza B HA Gene Plasmid Map
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Etiqueta on other vectors
Gripe B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11716-ACG$345
Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG11716-ACR$345
Gripe B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11716-C$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin natural ORF mammalian expression plasmid, HA EtiquetaVG11716-C-Y$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag EtiquetaVG11716-CF$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His EtiquetaVG11716-CH$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc EtiquetaVG11716-CM$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA EtiquetaVG11716-CY$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag EtiquetaVG11716-NF$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His EtiquetaVG11716-NH$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11716-NM$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA EtiquetaVG11716-NY$315
Gripe B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11716-UT$315
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG11716-NH
Precio de lista: 
Precio:      (You Save: )
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
  • Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) natural ORF mammalian expression plasmid, N-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.