After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human LY86 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004271.3.
Tamaño de cDNA:489bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens lymphocyte antigen 86 with Flag tag.
Sinónimo de gen:LY86, MD-1, MMD-1, dJ80N2.1, RP1-80N2.1
Especie:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-LY86-flag
Sitio de restricción:KpnI + XhoI (5.4kb + 0.54kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10242-ACG$225
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10242-ACR$225
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10242-CF$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10242-CH$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10242-CM$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10242-CY$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(Vector de expresión)HG10242-M$75
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10242-M-F$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10242-NF$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10242-NH$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10242-NM$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10242-NY$195
Humano MD1 / MMD-1 / LY86 clonación del ADN o clonación génica(vector de clonación)HG10242-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

MD-1 and MD-2 are secretory glycoproteins that exist on the cell surface in complexes with transmembrane proteins. MD-1 is anchored by radioprotective 105 (RP105) which is a molecule containing leucine-rich repeats and is expressed on B cells, dentritic cells and macrophages, while MD-2 is associated with TLR4. MD-1 is required for efficient RP105 cell surface expression and function. It is indicated that the RP105/MD1 complex, in conjunction with TLR4, mediates the innate immune response to LPS in B cells, and also plays a role in protecting against apoptosis, B-cell proliferation, etc. Mouse MD-1 cDNA encodes a 162 amino acid precursor protein with a putative 19 aa signal peptide and two potential N-linked glycosylation sites. It shares 40% and 66% amino acid sequence identity with chicken and human MD-1 respectively. MD-1 is mainly expressed in spleen, and also detectable in liver, brain, thymus, and kidney.

Size / Price
Catálogo: HG10242-M-F
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"