Pedido rápido

MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    MERS-CoV CoV-orf4a Información de producto de clon de cDNA
    Gene_bank_ref_id:JX869059.2
    Tamaño de cDNA:330bp
    Descripción de cDNA:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4a with N terminal His tag.
    Sinónimo de gen:CoV-orf4a
    Especie:MERS-CoV
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:Identical with the Gene Bank AFS88938 sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His Etiqueta on other vectors
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40083-ACG$325
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40083-ACR$325
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40083-ANG$325
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40083-ANR$325
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Flag EtiquetaVG40083-CF$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-His EtiquetaVG40083-CH$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Myc EtiquetaVG40083-CM$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA EtiquetaVG40083-CY$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid (Codon Optimized)VG40083-G$95
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Flag EtiquetaVG40083-NF$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His EtiquetaVG40083-NH$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Myc EtiquetaVG40083-NM$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-HA EtiquetaVG40083-NY$295
    MERS-CoV (NCoV / Novel coronavirus) orf4a natural ORF mammalian expression plasmidVG40083-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: VG40083-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"