After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
MERS-CoV CoV-orf4b Información de producto de clon de cDNA
Tamaño de cDNA:741bp
Descripción de cDNA:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with N terminal His tag.
Sinónimo de gen:CoV-orf4b
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank AFS88939.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His Etiqueta on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40084-ACG$325
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40084-ACR$325
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40084-ANG$325
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40084-ANR$325
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Flag EtiquetaVG40084-CF$295
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-His EtiquetaVG40084-CH$295
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Myc EtiquetaVG40084-CM$295
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA EtiquetaVG40084-CY$295
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid (Codon Optimized)VG40084-G$95
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Flag EtiquetaVG40084-NF$295
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His EtiquetaVG40084-NH$295
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Myc EtiquetaVG40084-NM$295
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-HA EtiquetaVG40084-NY$295
MERS-CoV (NCoV / Novel coronavirus) orf4b natural ORF mammalian expression plasmidVG40084-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40084-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.