Pedido rápido

Mouse 1810055G02RIK natural ORF mammalian expression plasmid

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse 1810055G02RIK Información de producto de clon de cDNA
Gene_bank_ref_id:NM_028077.2
Tamaño de cDNA:1179bp
Descripción de cDNA:Full length Clone DNA of Mus musculus RIKEN cDNA 1810055G02 gene.
Sinónimo de gen:AI256204
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: MG52455-UT
Precio de lista:   (Save )
Precio:      [How to order]
Disponibilidad2-3 weeksInstrucciones de envío
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"