Pedido rápido

Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón 4921524J17RIK Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_025722.3
    Tamaño de cDNA:465bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus RIKEN cDNA 4921524J17 gene with C terminal His tag.
    Sinónimo de gen:4921524J17Rik
    Especie:Mouse
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with 4921524J17RIK qPCR primers for gene expression analysis, MP202170 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52297-ACG$225
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52297-ACR$225
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52297-ANG$225
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52297-ANR$225
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52297-CF$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52297-CH$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52297-CM$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52297-CY$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(Vector de expresión)MG52297-G$75
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52297-NF$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52297-NH$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52297-NM$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52297-NY$195
    Ratón 4921524J17RIK clonación del ADN o clonación génica(vector de clonación)MG52297-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG52297-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"