After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ACP1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001110239.1
Tamaño de cDNA:477bp
Descripción de cDNA:Full length Clone DNA of Mus musculus acid phosphatase 1, soluble with C terminal Flag tag.
Sinónimo de gen:Acp-1, LMW-PTP, AI427468, 4632432E04Rik
Especie:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51014-ACG$225
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51014-ACR$225
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51014-ANG$225
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51014-ANR$225
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51014-CF$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51014-CH$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51014-CM$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51014-CY$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(Vector de expresión)MG51014-G$75
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51014-NF$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51014-NH$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51014-NM$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51014-NY$195
Ratón ACP1 / LMW-PTP clonación del ADN o clonación génica(vector de clonación)MG51014-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

Referencias
  • Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.
  • Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.
  • Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.
  • Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.
  • Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.
  • Size / Price
    Catálogo: MG51014-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"