Pedido rápido

Text Size:AAA

Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ACPP Información de producto de clon de cDNA
Tamaño de cDNA:1248bp
Descripción de cDNA:Full length Clone DNA of Mus musculus acid phosphatase, prostate with C terminal Flag tag.
Sinónimo de gen:Lap, PAP, Ppal, AI324033, A030005E02Rik, Acpp
Sitio de restricción:KpnI + XbaI (6kb + 1.3kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 126G/A and 174A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ACPP Gene Plasmid Map
Mouse ACPP Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Mouse ACPP Gene Expression validated Image
Mouse ACPP ORF mammalian expression plasmid, C-Flag tag
[Hacer clic para ampliar la imagen]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51018-ACG$225
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51018-ACR$225
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51018-CF$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51018-CH$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51018-CM$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51018-CY$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(Vector de expresión)MG51018-G$75
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51018-NF$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51018-NH$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51018-NM$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51018-NY$195
Ratón Prostatic Acid Phosphatase/ACPP clonación del ADN o clonación génica(vector de clonación)MG51018-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Prostatic acid phosphatase (PAP, or ACPP), also known as prostatic specific acid phosphatase (PSAP), is an enzyme produced by the prostate. As a non-specific phosphomonoesterase, Prostatic acid phosphatase synthetized and secreted into seminal plasma under androgenic control. The enzyme is a dimer of molecular weight around 100 kDa. Prostatic acid phosphatase is a clinically important protein for its relevance as a biomarker of prostate carcinoma. Furthermore, it has a potential role in fertilization. The major action of PAP is to dephosphorylate macromolecules with the help of catalytic residues (His(12) and Asp(258)) that are located in the cleft between two domains. Cellular prostatic acid phosphatase (cPAcP), an authentic tyrosine phosphatase, is proposed to function as a negative growth regulator of prostate cancer (PCa) cells in part through its dephosphorylation of ErbB-2. cPAcP functions as a neutral protein tyrosine phosphatase (PTP) in prostate cancer cells and dephosphorylates HER-2/ErbB-2/Neu (HER-2: human epidermal growth factor receptor-2) at the phosphotyrosine (p-Tyr) residues. Injection of the secretory isoform of PAP has potent antinociceptive effects in mouse models of chronic pain. This enzyme exhibits ecto-5'-nucleotidase activity, is widely distributed, and implicated in the formation of chronic pain. Additionally, PAP could be a target molecule in specific immunotherapy for patients with nonprostate adenocarcinomas including colon and gastric cancers.

  • Hassan MI, et al. (2010) Structural and functional analysis of human prostatic acid phosphatase. Expert Rev Anticancer Ther. 10(7): 1055-68.
  • Chuang TD, et al. (2010) Human prostatic acid phosphatase, an authentic tyrosine phosphatase, dephosphorylates ErbB-2 and regulates prostate cancer cell growth. J Biol Chem. 285(31): 23598-606.
  • Larsen RS, et al. (2009) A high throughput assay to identify small molecule modulators of prostatic acid phosphatase. Curr Chem Genomics. 3: 42-9.
  • Zimmermann H. (2009) Prostatic acid phosphatase, a neglected ectonucleotidase. Purinergic Signal. 5(3): 273-5.
  • Wang Y, et al. (2005) Prostatic acid phosphatase as a target molecule in specific immunotherapy for patients with nonprostate adenocarcinoma. J Immunother. 28(6): 535-41.
  • Veeramani S, et al. (2005) Cellular prostatic acid phosphatase: a protein tyrosine phosphatase involved in androgen-independent proliferation of prostate cancer. Endocr Relat Cancer. 12(4): 805-22.
  • Ostrowski WS, et al. (1994) Human prostatic acid phosphatase: selected properties and practical applications. Clin Chim Acta. 226(2): 121-9.
  • Size / Price
    Catálogo: MG51018-CF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Mouse ACPP Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Mouse ACPP ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.