Pedido rápido

Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse AGT Información de producto de clon de cDNA
Tamaño de cDNA:1449bp
Descripción de cDNA:Full length Clone DNA of Mus musculus angiotensinogen (serpin peptidase inhibitor, clade A, member 8) with C terminal Myc tag.
Sinónimo de gen:AngI, AngII, Aogen, AI265500, Serpina8
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50337-ACG$225
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50337-ACR$225
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50337-CF$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50337-CH$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50337-CM$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50337-CY$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(Vector de expresión)MG50337-G$75
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50337-NF$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50337-NH$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50337-NM$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50337-NY$195
Ratón Angiotensinogen/SerpinA8 clonación del ADN o clonación génica(vector de clonación)MG50337-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Angiotensinogen, also known as AGT and SerpinA8, is a member of the serpin family. It is an α-2-globulin that is produced constitutively and released into the circulation mainly by the liver. Angiotensinogen is a essential component of the renin-angiotensin system (RAS) and a potent regulator of blood pressure. Angiotensinogen can be schematically considered to consist of a combination of an angiotensin I (Ang I) function, located at the N-terminal end, and the presence of a serpin (serine protease inhibitor) structure at the opposite end. Angiotensinogen is cleaved into three chains: Angiotensin-1 (Ang I), Angiotensin-2 (Ang II), and Angiotensin-3 (Ang III). Angiotensin-1 is a substrate of ACE (angiotensin converting enzyme) that removes a dipeptide to yield the physiologically active peptide angiotensin-2. Angiotensin-1 and angiotensin-2 can be further processed to generate angiotensin-3, angiotensin-4. Angiotensin 1-7 is cleaved from angiotensin-2 by ACE2. Angiotensin-2 acts directly on vascular smooth muscle as a potent vasoconstrictor, affects cardiac contractility and heart rate through its action on the sympathetic nervous system. Defects in AGT are associated with susceptibility to essential hypertension and renal tubular dysgenesis (RTD). Several serpins (antithrombin, maspin, pigment epithelial-derived factor, and kallistatin) have been recently shown to exert an antiangiogenic activity, suggesting a common mechanism of endothelial cell proliferation and migration. Angiotensinogen/AGT and its renin-cleaved product, des(Ang I)AGT, are also angiogenesis inhibitors, both in vitro and in vivo at concentrations within the range of those observed in plasma. The Angiotensinogen products, that is angiotensin II and possibly angiotensin II-related products, have been found to act locally in modulating adipose tissue growth in an autocrine/paracrine manner. The transient or chronic overexpression of angiotensinogen in adipose tissue favors lipogenesis in adipocytes and leads to a 'vicious' circle whereby adipose tissue development is further increased.

  • Ailhaud G, et al. (2002) Angiotensinogen, adipocyte differentiation and fat mass enlargement. Curr Opin Clin Nutr Metab Care. 5(4): 385-9.
  • Corvol P, et al. (2003) Inhibition of angiogenesis: a new function for angiotensinogen and des(angiotensin I)angiotensinogen. Curr Hypertens Rep. 5(2): 149-54.
  • Size / Price
    Catálogo: MG50337-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.