After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse AK4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001177602.1
Tamaño de cDNA:672bp
Descripción de cDNA:Full length Clone DNA of Mus musculus adenylate kinase 4 with N terminal Myc tag.
Sinónimo de gen:Ak3, AK 4, Ak-3, Ak-4, Ak3l1, D4Ertd274e
Especie:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52601-ACG$225
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52601-ACR$225
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52601-ANG$225
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52601-ANR$225
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52601-CF$195
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52601-CH$195
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52601-CM$195
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52601-CY$195
Mouse AK4 Gene cDNA clone plasmidMG52601-G$75
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52601-NF$195
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52601-NH$195
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52601-NM$195
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52601-NY$195
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(Vector de expresión)MG52601-U$75
Ratón AK4 / Adenylate Kinase 4 / AK3L1 clonación del ADN o clonación génica(vector de clonación)MG52601-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member the adenylate kinase family. AK4 / AK3L1 is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. AK4 / AK3L1 catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP. It may also be active with GTP. Adenylate kinase 4 ( AK4 / AK3L1 ) is a unique member with no enzymatic activity in the adenylate kinase (AK) family although it shares high sequence homology with other AKs. It remains unclear what physiological function AK4 might play or why it is enzymatically inactive. AK4 / AK3L1 retains the capability of binding nucleotides. It has a glutamine residue instead of a key arginine residue in the active site well conserved in other AKs. The enzymatically inactive AK4 is a stress responsive protein critical to cell survival and proliferation. AK4 / AK3L1 is likely that the interaction with the mitochondrial inner membrane protein ANT is important for AK4 to exert the protective benefits to cells under stress. AK4 / AK3L1 also acts on the specific mechanism of energy metabolism rather than control of the homeostasis of the ADP pool ubiquitously.

Size / Price
Catálogo: MG52601-NM
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"