After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse AKR1B3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_009658.3
Tamaño de cDNA:951bp
Descripción de cDNA:Full length Clone DNA of Mus musculus aldo-keto reductase family 1, member B3 (aldose reductase) with C terminal His tag.
Sinónimo de gen:AR, ALR2, Ahr1, Ahr-1, Aldr1, Akr1b1, Aldor1
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52283-ACG$225
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52283-ACR$225
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52283-ANG$225
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52283-ANR$225
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52283-CF$195
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52283-CH$195
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52283-CM$195
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52283-CY$195
Ratón AKR1B3 clonación del ADN o clonación génica(Vector de expresión)MG52283-G$75
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52283-NF$195
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52283-NH$195
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52283-NM$195
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52283-NY$195
Ratón AKR1B3 clonación del ADN o clonación génica(vector de clonación)MG52283-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52283-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"