After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ALDH7A1 Información de producto de clon de cDNA
Tamaño de cDNA:1536bp
Descripción de cDNA:Full length Clone DNA of Mus musculus aldehyde dehydrogenase family 7, member A1 with C terminal Flag tag.
Sinónimo de gen:Atq1, D18Wsu181e
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52196-ACG$245
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52196-ACR$245
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52196-ANG$245
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52196-ANR$245
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52196-CF$215
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52196-CH$215
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52196-CM$215
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52196-CY$215
Ratón ALDH7A1 clonación del ADN o clonación génica(Vector de expresión)MG52196-G$75
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52196-NF$215
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52196-NH$215
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52196-NM$215
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52196-NY$215
Ratón ALDH7A1 clonación del ADN o clonación génica(vector de clonación)MG52196-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. Mammalian ALDH7A1 is homologous to plant ALDH7B1 which protects against various forms of stress such as increased salinity, dehydration and treatment with oxidants or pesticides. In mammals, ALDH7A1 is known to play a primary role during lysine catabolism through the NAD+-dependent oxidative conversion of aminoadipate semialdehyde (AASA) to its corresponding carboxylic acid, α-aminoadipic acid. Deleterious mutations in human ALDH7A1 are responsible for pyridoxine-dependent and folinic acid-responsive seizures. ALDH7A1 is a novel aldehyde dehydrogenase expressed in multiple subcellular compartments that protects against hyperosmotic stress by generating osmolytes and metabolizing toxic aldehydes.

  • Brocker C, et al. (2011) Aldehyde dehydrogenase 7A1 (ALDH7A1) attenuates reactive aldehyde and oxidative stress induced cytotoxicity. Chem Biol Interact. 191(1-3): 269-77.
  • Brocker C, et al. (2010) Aldehyde dehydrogenase 7A1 (ALDH7A1) is a novel enzyme involved in cellular defense against hyperosmotic stress. J Biol Chem. 285(24): 18452-63.
  • Size / Price
    Catálogo: MG52196-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.