Pedido rápido

Text Size:AAA

Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón ANAPC2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_175300.4
    Tamaño de cDNA:2514bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus anaphase promoting complex subunit 2 with N terminal His tag.
    Sinónimo de gen:Apc2, Emi4, Imi4, AL024279, mKIAA1406, 9230107K09Rik
    Especie:Mouse
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANAPC2 qPCR primers for gene expression analysis, MP201996 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52123-ACG$325
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52123-ACR$325
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52123-ANG$325
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52123-ANR$325
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52123-CF$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52123-CH$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52123-CM$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52123-CY$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(Vector de expresión)MG52123-G$75
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52123-NF$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52123-NH$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52123-NM$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52123-NY$295
    Ratón Apc2/ANAPC2 clonación del ADN o clonación génica(vector de clonación)MG52123-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG52123-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"