After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse APBB1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001253885.1
Tamaño de cDNA:2133bp
Descripción de cDNA:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor protein-binding, family B, member 1 with C terminal His tag.
Sinónimo de gen:Rir, Fe65
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51732-ACG$245
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51732-ACR$245
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51732-ANG$245
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51732-ANR$245
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51732-CF$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51732-CH$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51732-CM$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51732-CY$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(Vector de expresión)MG51732-G$75
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51732-NF$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51732-NH$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51732-NM$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51732-NY$215
Ratón FE65/APBB1 clonación del ADN o clonación génica(vector de clonación)MG51732-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51732-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"