After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse APCS Información de producto de clon de cDNA
Gene_bank_ref_id:NM_011318.1
Tamaño de cDNA:675bp
Descripción de cDNA:Full length Clone DNA of Mus musculus serum amyloid P-component with N terminal His tag.
Sinónimo de gen:Sap
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50113-ACG$225
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50113-ACR$225
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50113-CF$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50113-CH$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50113-CM$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50113-CY$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(Vector de expresión)MG50113-M$75
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50113-NF$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50113-NH$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50113-NM$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50113-NY$195
Ratón Serum amyloid P component clonación del ADN o clonación génica(vector de clonación)MG50113-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.

Referencias
  • Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.
  • Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.
  • Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.
  • de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.
  • Size / Price
    Catálogo: MG50113-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"