Pedido rápido

Text Size:AAA

Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse APLP1 Información de producto de clon de cDNA
Tamaño de cDNA:1965bp
Descripción de cDNA:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor-like protein 1 with C terminal His tag.
Sinónimo de gen:Aplp1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51730-ACG$245
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51730-ACR$245
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51730-CF$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51730-CH$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51730-CM$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51730-CY$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(Vector de expresión)MG51730-G$75
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51730-NF$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51730-NH$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51730-NM$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51730-NY$215
Ratón APLP1 / Amyloid-like Proteína 1 clonación del ADN o clonación génica(vector de clonación)MG51730-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

APLP1, also known as amyloid-like protein 1, is a member of the highly conserved amyloid precursor protein gene family. APLP1 is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. APLP1, together with APLP2, are important modulators of glucose. APLP1 may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. APLP1 also is a mammalian homologue of amyloid precursor protein (APP). APP is a type I membrane protein that is genetically linked to Alzheimer's disease.

  • Wasco W. et al., 1993, Genomics. 15 (1): 237-9.
  • Needham BE. et al., 2008, J Pathol. 215 (2): 155-63.
  • Bayer TA. et al., 2000, Mol Psychiatry. 4 (6): 524-8.
  • Lee S. et al., 2011, Biochemistry. 50 (24): 5453-64.
  • Size / Price
    Catálogo: MG51730-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.