After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse APP Información de producto de clon de cDNA
Gene_bank_ref_id:NM_007471.2
Tamaño de cDNA:2088bp
Descripción de cDNA:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor protein with C terminal Flag tag.
Sinónimo de gen:Adap, Cvap, Abeta, appican, betaAPP, AL024401, E030013M08Rik, App
Especie:Mouse
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-mAPP-Flag
Sitio de restricción:HindIII + XbaI (6kb + 2.13kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 G>A, 498 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse APP Gene Plasmid Map
Mouse APP / PN2 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50402-ACG$245
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50402-ACR$245
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50402-CF$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50402-CH$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50402-CM$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50402-CY$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(Vector de expresión)MG50402-M$75
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50402-NF$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50402-NH$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50402-NM$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50402-NY$215
Ratón Amyloid beta A4 Proteína clonación del ADN o clonación génica(vector de clonación)MG50402-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the synapses of neurons, and is suggested as a regulator of synapse formation and neural plasticity. APP can be processed by two different proteolytic pathways. In one pathway, APP is cleaved by β- and γ-secretase to produce the amyloid-β-protein (Aβ, Abeta, beta-amyloid) which is the principal component of the amyloid plaques, the major pathological hallmark of Alzheimer’s disease (AD), while in the other pathway, α-secretase is involved in the cleavage of APP whose product exerts antiamyloidogenic effect and prevention of the Aβ peptide formation. The aberrant accumulation of aggregated beta-amyloid peptides (Abeta) as plaques is a hallmark of AD neuropathology and reduction of Abeta has become a leading direction of emerging experimental therapies for the disease. Besides this pathological function of Abeta, recently published data reveal that Abeta also has an essential physiological role in lipid homeostasis. Cholesterol increases Abeta production, and conversely A beta production causes a decrease in cholesterol synthesis. Abeta may be part of a mechanism controlling synaptic activity, acting as a positive regulator presynaptically and a negative regulator postsynaptically. The pathological accumulation of oligomeric Abeta assemblies depresses excitatory transmission at the synaptic level, but also triggers aberrant patterns of neuronal circuit activity and epileptiform discharges at the network level. Abeta-induced dysfunction of inhibitory interneurons likely increases synchrony among excitatory principal cells and contributes to the destabilization of neuronal networks. There is evidence that beta-amyloid can impair blood vessel function. Vascular beta-amyloid deposition, also known as cerebral amyloid angiopathy, is associated with vascular dysfunction in animal and human studies. Alzheimer disease is associated with morphological changes in capillary networks, and soluble beta-amyloid produces abnormal vascular responses to physiological and pharmacological stimuli.

Referencias
  • Grimm MO, et al. (2007) Amyloid beta as a regulator of lipid homeostasis. Trends Mol Med. 13(8): 337-44.
  • Smith EE, et al. (2009) Beta-amyloid, blood vessels, and brain function. Stroke. 40(7): 2601-6.
  • Gouras GK, et al. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119(5): 523-41.
  • Palop JJ, et al. (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nat Neurosci. 13(7): 812-8.
  • Size / Price
    Catálogo: MG50402-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human CD151 ORF mammalian expression plasmid, C-Flag tag
    • Mouse APP / PN2 natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"