After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse APPBP2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_025825.3
Tamaño de cDNA:1758bp
Descripción de cDNA:Full length Clone DNA of Mus musculus amyloid beta precursor protein (cytoplasmic tail) binding protein 2 with N terminal His tag.
Sinónimo de gen:PAT1; AI465480; 1300003O07Rik
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51984-ACG$245
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51984-ACR$245
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51984-ANG$245
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51984-ANR$245
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51984-CF$75
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51984-CH$215
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51984-CM$215
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51984-CY$215
Mouse APPBP2 Gene cDNA clone plasmidMG51984-G$75
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51984-NF$215
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51984-NH$215
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51984-NM$215
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51984-NY$215
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(Vector de expresión)MG51984-U$75
Ratón PAT1/APPBP2 clonación del ADN o clonación génica(vector de clonación)MG51984-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51984-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"