Pedido rápido

Text Size:AAA

Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ARF6 Información de producto de clon de cDNA
Tamaño de cDNA:528bp
Descripción de cDNA:Full length Clone DNA of Mus musculus ADP-ribosylation factor 6 with N terminal His tag.
Sinónimo de gen:AI788669, AW496366
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51972-ACG$225
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51972-ACR$225
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51972-ANG$225
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51972-ANR$225
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51972-CF$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51972-CH$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51972-CM$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51972-CY$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(Vector de expresión)MG51972-G$75
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51972-NF$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51972-NH$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51972-NM$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51972-NY$195
Ratón Arf6/ADP-ribosylation factor 6 clonación del ADN o clonación génica(vector de clonación)MG51972-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51972-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.