ARL8B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

ARL8B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
561 bp
Description
Full length Clone DNA of Mouse ADP-ribosylation factor-like 8B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ARL8B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

2610313E07Rik cDNA ORF Clone, Mouse; 3100002J04Rik cDNA ORF Clone, Mouse; Arl10c cDNA ORF Clone, Mouse; gie1 cDNA ORF Clone, Mouse

ARL8B Background Information

Full Name
ADP-ribosylation factor-like 8B
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait