ART1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

ART1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
978 bp
Description
Full length Clone DNA of Mouse ADP-ribosyltransferase 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ART1 cDNA ORF Clone, Mouse, untagged: Alternative Names

ADPRT cDNA ORF Clone, Mouse; ARTC1 cDNA ORF Clone, Mouse; Yac-1 cDNA ORF Clone, Mouse

ART1 Background Information

Mono-ADP-ribosyltransferase (ART) 1 belongs to a family of mammalian ectoenzymes that catalyze the transfer of ADP-ribose from NAD+ to a target protein. ART1 is predominantly expressed in skeletal and cardiac muscle. It ADP-ribosylates alpha7-integrin which together with beta1-integrin forms a dimer and binds to laminin, a protein of the extracellular matrix involved in cell adhesion. This posttranslational modification leads to an increased laminin binding affinity. The differentiation-dependent upregulation of ART1 mRNA is induced by the binding of myogenin to an E box and of MEF-2 to an A/T-rich element in the proximal promoter region of the ART1 gene. Colorectal carcinoma is one of the most common cancers world-wide, with high morbidity and mortality rates. Arginine ADP-ribosyltransferase 1(ART1) is an important ecto-ADP-ribose transferase and has been proven to be intimately involved in a number of biological processes. The molecular mechanism for the function of ART1 in colorectal carcinoma and defines a potential therapeutic target for the enhanced treatment of this prominent world-wide disease
Full Name
ADP-ribosyltransferase 1

ART1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait