After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ANGPTL4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_020581.2
Tamaño de cDNA:1233bp
Descripción de cDNA:Full length Clone DNA of Mus musculus angiopoietin-like 4 with C terminal Myc tag.
Sinónimo de gen:Arp4, Bk89, Fiaf, Ng27, Pgar, Hfarp, Pgarg, Pp1158, Angptl4
Especie:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50356-ACG$225
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50356-ACR$225
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50356-CF$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50356-CH$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50356-CM$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50356-CY$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(Vector de expresión)MG50356-M$75
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50356-NF$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50356-NH$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50356-NM$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50356-NY$195
Ratón ANGPTL4 / angiopoietin-like Proteína 4 clonación del ADN o clonación génica(vector de clonación)MG50356-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

Referencias
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Catálogo: MG50356-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"