Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Mouse angiopoietin-like 7 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Angiopoietin-like 7 Background Information

ANGPTL7 is a member of the Angiopoietin-like (ANGPTL) protein family that is composed of eight proteins (1-8). Increasing evidence is associating ANGPTL proteins to obesity and insulin resistance. Obesity increases the level of ANGPTL7 in both plasma and adipose tissue. Increased expression of ANGPTL7 might play a minor role in the regulation of TG level in obese subjects either directly or through interaction with other ANGPTL protein members. Physical exercise reduced the level of ANGPTL7 highlighting the potential for targeting this protein as a therapeutic target for regulating dyslipidemia. Angptl7 is a factor that promotes pro-inflammatory responses in macrophages through the P38 MAPK signaling pathway and represents a potential therapeutic target for treatment of inflammatory diseases. Expression of ANGPTL7 (angiopoietin-like 7), a protein not previously linked to metastasis, was highly up-regulated in cancer cells after myeloid cell depletion. This effect was duplicated in tissue culture, where coculture of cancer cells with tumor-conditioned myeloid cells from liver metastases or myeloid cell conditioned media down-regulated ANGPTL7 expression. Analogous to myeloid cell depletion, overexpression of ANGPTL7 in cancer cells significantly reduced hepatic metastasis formation and angiogenesis. We found that ANGPTL7 itself has strong antiangiogenic effects in vitro. Furthermore, analysis of The Cancer Genome Atlas colorectal and breast cancer data sets revealed striking ANGPTL7 underexpression in cancerous compared to normal tissues. Also, ANGPTL7 was down-regulated in metastatic liver colonies of colorectal cancer patients compared to their adjacent liver tissue.The secreted growth factor ANGPTL7 as a regulator of both human hematopoietic stem and progenitor cell expansion and regeneration.
Full Name
angiopoietin-like 7
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait