Pedido rápido

Ratón AXL clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse AXL Información de producto de clon de cDNA
Tamaño de cDNA:2667bp
Descripción de cDNA:Full length Clone DNA of Mus musculus AXL receptor tyrosine kinase with N terminal His tag.
Sinónimo de gen:Ark, Ufo, Tyro7, AI323647, Axl
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Axl receptor tyrosine kinase, together with Tyro3 and Mer, constitute the TAM family of receptor tyrosine kinases. In the nervous system, Axl and its ligand Growth-arrest-specific protein 6 (Gas6) are expressed on multiple cell types. Axl functions in dampening the immune response, regulating cytokine secretion, clearing apoptotic cells and debris, and maintaining cell survival. Axl is upregulated in various disease states, such as in the cuprizone toxicity-induced model of demyelination and in multiple sclerosis (MS) lesions, suggesting that it plays a role in disease pathogenesis. Axl expression correlates with poor prognosis in several cancers. Axl mediates multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Axl contributes to cell survival, migration, invasion, metastasis and chemosensitivity justify further investigation of Axl as novel therapeutic targets in cancer. The receptor tyrosine kinase AXL is thought to play a role in metastasis. The soluble AXL receptor as a therapeutic candidate agent for treatment of metastatic ovarian cancer. GAS6/AXL targeting as an effective strategy for inhibition of metastatic tumor progression in vivo.

  • Weinger JG, et al. (2011) Loss of the receptor tyrosine kinase Axl leads to enhanced inflammation in the CNS and delayed removal of myelin debris during Experimental Autoimmune Encephalomyelitis. J Neuroinflammation. 8: 49.
  • Linger RM, et al. (2010) Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors. Expert Opin Ther Targets. 14(10): 1073-90.
  • Cavet ME, et al. (2010) Gas6-Axl pathway: the role of redox-dependent association of Axl with nonmuscle myosin IIB. Hypertension. 56(1): 105-11.
  • Rankin EB, et al. (2010) AXL is an essential factor and therapeutic target for metastatic ovarian cancer. Cancer Res. 70(19): 7570-9.
  • Size / Price
    Catálogo: MG50126-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.