After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse BACE2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_019517.4
Tamaño de cDNA:1545bp
Descripción de cDNA:Full length Clone DNA of Mus musculus beta-site APP-cleaving enzyme 2 with C terminal Flag tag.
Sinónimo de gen:ARP1, BAE2, DRAP, AEPLC, ALP56, ASP21, CDA13, CEAP1, AI850424, 1110059C24Rik, Bace2
Especie:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51031-ACG$245
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51031-ACR$245
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51031-CF$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51031-CH$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51031-CM$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51031-CY$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(Vector de expresión)MG51031-G$75
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51031-NF$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51031-NH$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51031-NM$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51031-NY$215
Ratón BACE2 / Beta secretase 2 clonación del ADN o clonación génica(vector de clonación)MG51031-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

BACE2, also known as beta secretase 2, belongs to the peptidase A1 family. It is a protease known to be an important enzyme involved in the cellular pathways. BACE2 has been shown to interact with GGA1 and GGA2. It is the major β-secretase in vivo. BACE2 is located on chromosome 21 and may play a role in alzheimer's disease pathogenesis in down syndrome(DS). Overexpression of BACE2 by lentivirus markedly reduced amyloid β protein production in primary neurons. Despite an extra copy of the BACE2 gene in DS and the increase of its transcription, BACE2 protein levels are unchanged.

Referencias
  • Hussain I, et al. (2001) Prodomain processing of Asp1 (BACE2) is autocatalytic. J Biol Chem. 276(26):23322-8.
  • Solans A, et al. (2000) A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet. 89(3-4): 177-84.
  • Hussain I, et al. (2001) ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci. 16(5):609-19.
  • Size / Price
    Catálogo: MG51031-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"