Pedido rápido

Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón TNFRSF13C Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_028075.2
    Tamaño de cDNA:528bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 13c with C terminal Myc tag.
    Sinónimo de gen:Bcmd, Baffr, Bcmd1, BAFF-R, Bcmd-1, Lvis22, MGC123890, MGC123891, 2010006P15Rik, Tnfrsf13c
    Especie:Mouse
    Vector:pCMV3-C-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFRSF13C qPCR primers for gene expression analysis, MP200374 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50353-ACG$225
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50353-ACR$225
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50353-CF$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50353-CH$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50353-CM$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50353-CY$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(Vector de expresión)MG50353-M$75
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50353-NF$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50353-NH$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50353-NM$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50353-NY$195
    Ratón BAFFR / TNFRSF13C / CD268 clonación del ADN o clonación génica(vector de clonación)MG50353-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268 antigen, is a member of the tumor necrosis factor receptor superfamily. A tumor necrosis factor receptor (TNFR), or death receptor, is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. It has been proposed that abnormally high levels of BAFFR/TNFRSF13C (CD268) may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells.

    Referencias
  • Ashkenazi A, et al. (1998) Death receptors: signaling and modulation. Science. 281(5381): 1305-8.
  • Losi CG, et al. (2005) Mutational analysis of human BAFF receptor TNFRSF13C (BAFF-R) in patients with common variable immunodeficiency. J Clin Immunol. 25(5): 496-502.
  • Hentges KE, et al. (2002) Tnfrsf13c (Baffr) is mis-expressed in tumors with murine leukemia virus insertions at Lvis22. Genomics. 80(2): 204-12.
  • Size / Price
    Catálogo: MG50353-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"