Pedido rápido

Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

  • Human PKM2 Gene Plasmid Map 5788
Hoja de datosReseñasProductos relacionadosProtocolos
Ratón BCL11A Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001159290.1
Tamaño de cDNA:621 bp
Descripción de cDNA:Full length Clone DNA of Mus musculus B cell CLL/lymphoma 11A (zinc finger protein) with N terminal His tag.
Sinónimo de gen:Evi9, Ctip1, Evi9a, Evi9b, Evi9c, BCL-11A, mKIAA1809, 2810047E18Rik, D930021L15Rik
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:PCMV3-His-mBCL11A
Sitio de restricción:KpnI + NotI(6kb+0.62kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BCL11A qPCR primers for gene expression analysis, MP202424 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52551-ACG$225
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52551-ACR$225
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52551-ANG$225
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52551-ANR$225
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52551-CF$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52551-CH$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52551-CM$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52551-CY$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(Vector de expresión)MG52551-G$75
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52551-NF$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52551-NH$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52551-NM$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52551-NY$195
Ratón Ctip1/BCL11A clonación del ADN o clonación génica(vector de clonación)MG52551-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52551-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"