After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse BID Información de producto de clon de cDNA
Gene_bank_ref_id:NM_007544.3
Tamaño de cDNA:588bp
Descripción de cDNA:Full length Clone DNA of Mus musculus BH3 interacting domain death agonist with C terminal Myc tag.
Sinónimo de gen:AI875481, AU022477, 2700049M22Rik, Bid
Especie:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50351-ACG$225
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50351-ACR$225
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50351-ANG$225
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50351-ANR$225
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50351-CF$195
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50351-CH$195
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50351-CM$195
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50351-CY$195
Ratón p22 BID clonación del ADN o clonación génica(Vector de expresión)MG50351-M$75
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50351-NF$195
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50351-NH$195
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50351-NM$195
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50351-NY$195
Ratón p22 BID clonación del ADN o clonación génica(vector de clonación)MG50351-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.

Referencias
  • Gross A. (2006) BID as a double agent in cell life and death. Cell Cycle. 5(6): 582-4.
  • Yin XM. (2007) Bid, a BH3-only multi-functional molecule, is at the cross road of life and death. Gene. 369: 7-19.
  • Esposti MD. (2002) The roles of Bid. Apoptosis. 7(5): 433-40.
  • Yin XM. (2000) Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways. Cell Res. 10(3): 161-7.
  • Yin XM. (2000) Bid, a critical mediator for apoptosis induced by the activation of Fas/TNF-R1 death receptors in hepatocytes. J Mol Med. 78(4): 203-11.
  • Size / Price
    Catálogo: MG50351-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"