Pedido rápido

Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse C1QBP Información de producto de clon de cDNA
Tamaño de cDNA:840bp
Descripción de cDNA:Full length Clone DNA of Mus musculus complement component 1, q subcomponent binding protein with N terminal Myc tag.
Sinónimo de gen:P32, HABP1, gC1qBP, AA407365, AA986492, D11Wsu182e, C1qbp
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50199-ACG$225
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50199-ACR$225
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50199-ANG$225
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50199-ANR$225
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50199-CF$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50199-CH$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50199-CM$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50199-CY$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(Vector de expresión)MG50199-M$75
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50199-NF$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50199-NH$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50199-NM$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50199-NY$195
Ratón C1QBP/HABP1 clonación del ADN o clonación génica(vector de clonación)MG50199-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Hyaluronan binding protein 1 (HABP1), also known as p32 or gC1qR, is a ubiquitously expressed multifunctional phospho-protein implicated in cell signalling. Hyaluronan-binding protein 1 (HABP1) /p32/gC1qR was characterized as a highly acidic and oligomeric protein, which binds to different ligands like hyaluronan, C1q, and mannosylated albumin. The role of hyaluronan binding protein 1 (HABP1) in cell signaling was investigated and in vitro. HABP1 overexpressing cells showed extensive vacuolation and reduced growth rate, which was corrected by frequent medium replenishment. Further investigation revealed that HABP1 overexpressing cells undergo apoptosis, and they failed to enter into the S-phase. The sperm surface HABP1 level can be correlated with the degree of sperm motility.Hyaluronan binding protein 1 (HABP1) was reported to be present on human sperm surface and its involvement in fertilization has already been elucidated: decreased HABP1 level may be associated with low motility of sperms, which in turn might cause infertility in the patient. HABP1 also is an endogenous substrate for MAP kinase and upon mitogenic stimulation it is translocated to the nucleus in a MAP kinase-dependent manner.

  • Meenakshi J, et al. (2003) Constitutive expression of hyaluronan binding protein 1 (HABP1/p32/gC1qR) in normal fibroblast cells perturbs its growth characteristics and induces apoptosis. Biochemicaland Biophysical Research Communication. 300(3): 686-93.
  • Majumdar M, et al. (2002) Hyaluronan Binding Protein 1 (HABP1) /C1QBP/p32 Is an Endogenous Substrate for MAP Kinase and Is Translocated to the Nucleus upon Mitogenic Stimulation. Biochemical and Biophysical Research Communications. 291(4): 829-37.
  • Ghosh I, et al. (2002) Reduction in the level of hyaluronan binding protein 1 (HABP1) is associated with loss of sperm motility. Journal of Reproductive Immunology. 53(1-2): 45-54.
  • Size / Price
    Catálogo: MG50199-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.