After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CALM2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_007589.5
Tamaño de cDNA:450bp
Descripción de cDNA:Full length Clone DNA of Mus musculus calmodulin 2.
Sinónimo de gen:AL024017, 1500001E21Rik
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51329-ACG$225
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51329-ACR$225
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51329-ANG$225
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51329-ANR$225
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51329-CF$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51329-CH$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51329-CM$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51329-CY$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51329-NF$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51329-NH$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51329-NM$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51329-NY$195
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(Vector de expresión)MG51329-U$75
Ratón Calmodulin 2 / CALM2 clonación del ADN o clonación génica(vector de clonación)MG51329-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

Referencias
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • Size / Price
    Catálogo: MG51329-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"