After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CAMK1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_133926.2
Tamaño de cDNA:1125bp
Descripción de cDNA:Full length Clone DNA of Mus musculus calcium/calmodulin-dependent protein kinase I with C terminal Myc tag.
Sinónimo de gen:AI505105, CaMKIalpha, D6Ertd263e
Especie:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52781-ACG$225
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52781-ACR$225
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52781-ANG$225
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52781-ANR$225
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52781-CF$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52781-CH$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52781-CM$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52781-CY$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(Vector de expresión)MG52781-G$75
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52781-NF$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52781-NH$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52781-NM$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52781-NY$195
Ratón CAMKI/CAMK1 clonación del ADN o clonación génica(vector de clonación)MG52781-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Calcium/calmodulin-dependent protein kinase or CaM kinases are serine/threonine-specific protein kinases that are primarily regulated by the Calcium/calmodulin complex. These kinases show a memory effect on activation. CaM kinases activity can outlast the intracellular calcium transient that is needed to activate it. In neurons, this property is important for the induction of synaptic plasticity. Pharmacological inhibition of CaM kinases II blocks the induction of long-term potentiation. Upon activation, CaM kinases II phosphorylates postsynaptic glutamate receptors and changes the electrical properties of the synapse.

Calcium/calmodulin-dependent protein kinase type 1D, also known as CaM kinase I delta, CaM kinase ID, CaMKI-like protein kinase, CKLiK and CAMK1D, is a member of the protein kinase superfamily and CaMK subfamily. It contains one protein kinase domain. CAMK1D is broadly expressed. It is highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. Engineered overexpression of CAMK1D in non-tumorigenic breast epithelial cells led to increased cell proliferation, and molecular and phenotypic alterations indicative of epithelial-mesenchymal transition (EMT), including loss of cell-cell adhesions and increased cell migration and invasion. CAMK1D is a potential therapeutic target with particular relevance to clinically unfavorable basal-like tumors.

Referencias
  • Lisman, JE. et al., 1985, Proc Natl Acad Sci USA. 82 (9): 3055-7.
  • Bergamaschi, A. et al., 2008, Mol Oncol. 2 (4): 327-39.
  • White RB. et al., 2008, Physiological genomics, 33 (1): 41-9.
  • Schleinitz, D. et al., 2010, Horm Metab Res. 42 (1): 14-22.
  • Size / Price
    Catálogo: MG52781-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"