Pedido rápido

Text Size:AAA

Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón CCDC115 Información de producto de clon de cDNA
    Tamaño de cDNA:543bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus coiled-coil domain containing 115 with N terminal His tag.
    Sinónimo de gen:Ccp1, 2310061I09Rik
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    ( We provide with CCDC115 qPCR primers for gene expression analysis, MP202411 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52538-ACG$225
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52538-ACR$225
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52538-ANG$225
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52538-ANR$225
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52538-CF$195
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52538-CH$195
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52538-CM$195
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52538-CY$195
    Ratón CCDC115 clonación del ADN o clonación génica(Vector de expresión)MG52538-G$75
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52538-NF$195
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52538-NH$195
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52538-NM$195
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52538-NY$195
    Ratón CCDC115 clonación del ADN o clonación génica(vector de clonación)MG52538-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG52538-NH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.