Pedido rápido

Text Size:AAA

Ratón CD2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CD2 Información de producto de clon de cDNA
Tamaño de cDNA:1035bp
Descripción de cDNA:Full length Clone DNA of Mus musculus CD2 antigen with N terminal HA tag.
Sinónimo de gen:Ly37, LFA-2, Ly-37, Cd2
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I membrane protein. It contains one Ig-like C2-type domain and one Ig-like V-type domain. CD2 is a cell adhesion molecule expressed on T cells and is recognized as a target for CD48 (rats) and CD58 (humans). CD2 has been shown to set quantitative thresholds in T cell activation both in vivo and in vitro. Further, intracellular CD2 signaling pathways and networks are being discovered by the identification of several cytosolic tail binding proteins. CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain of CD2 is implicated in the signaling function. The complex of CD2 and CD58 also plays an important role in enhancing the adhesion of T lymphocytes to target cells, and promoting hyperplasia and activation of T lymphocytes. As a cell surface glycoprotein, CD2 expressed on most human T cells and natural killer (NK) cells and plays an important role in mediating cell adhesion in both T-lymphocytes and in signal transduction.

  • Yang JJ, et al. (2001) Structural biology of the cell adhesion protein CD2: alternatively folded states and structure-function relation. Curr Protein Pept Sci. 2(1): 1-17.
  • Wilkins AL, et al. (2003) Structural biology of the cell adhesion protein CD2: from molecular recognition to protein folding and design. Curr Protein Pept Sci. 4(5): 367-73.
  • McNerney ME, et al. (2006) The CD2 family of natural killer cell receptors. Curr Top Microbiol Immunol. 298: 91-120.
  • Size / Price
    Catálogo: MG50537-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.