Pedido rápido

Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón CD27 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001033126.2
Tamaño de cDNA:753bp
Descripción de cDNA:Full length Clone DNA of Mus musculus CD27 antigen, transcript variant 1 with N terminal His tag.
Sinónimo de gen:S152, Tp55, Tnfrsf7, Cd27
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mCD27
Sitio de restricción:KpnI + XbaI (6kb + 0.84kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CD27 qPCR primers for gene expression analysis, MP200140 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón CD27 Gene Plasmid Map
Mouse CD27 / TNFRSF7 transcript variant 1 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50110-ACG$225
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50110-ACR$225
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50110-CF$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50110-CH$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50110-CM$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50110-CY$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)MG50110-M$75
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50110-NF$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50110-NH$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50110-NM$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50110-NY$195
Ratón CD27/TNFRSF7 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)MG50110-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD70 on lymphocytes and dendritic cells. The CD27-CD70 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referencias
  • Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.
  • Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.
  • Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.
  • Size / Price
    Catálogo: MG50110-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry
    Contact Us
    Imágenes
    • Mouse CD27 / TNFRSF7 transcript variant 1 ORF mammalian expression plasmid, N-His tag
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"