After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Mouse CD27 / TNFRSF7 transcript variant 1 ORF mammalian expression plasmid, N-His tag

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CD27 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001033126.2
Tamaño de cDNA:753bp
Descripción de cDNA:Full length Clone DNA of Mus musculus CD27 antigen, transcript variant 1 with N terminal His tag.
Sinónimo de gen:S152, Tp55, Tnfrsf7, Cd27
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mCD27
Sitio de restricción:KpnI + XbaI (6kb + 0.84kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD27 Gene Plasmid Map
Mouse CD27 / TNFRSF7 transcript variant 1 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Human TL1A / TNFSF15 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Rabbit NGFR / TNFRSF16 / P75 Protein (ECD, His Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Rhesus OX40 / CD134 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman BLyS / TNFSF13B / BAFF ProteinHuman DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 Protein (His Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinHuman Osteoprotegerin / TNFRSF11B Protein (His Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Mouse TNFSF12 Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human TNFSF10 / TRAIL / APO-2L / CD253 ProteinHuman TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TNFRSF17 / BCMA / CD269 Protein (Fc Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Rhesus CD137 / 4-1BB Protein (His Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinHuman XEDAR / EDA2R Protein (His Tag)Human TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Human OX-40L / TNFSF4 / CD252 Protein (Fc Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Mouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinMouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Human CD153 / CD30L / TNFSF8 ProteinMouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Ferret TNF-alpha / TNFA ProteinCanine TNF-alpha / TNFA / TNFSF1A ProteinCanine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Rat TNF-alpha / TNFA ProteinRat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat TNFSF15 / TL1A Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rat TNFSF12 Protein (Fc Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Rat LTBR / TNFRSF3 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat EDAR Protein (Fc Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinRhesus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus / Human TNFSF12 Protein (Fc Tag)Rhesus CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Rhesus CD40 / TNFRSF5 Protein (His Tag)Rhesus TNFSF10 / TRAIL / APO-2L ProteinRhesus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Rhesus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human TNFRSF11A Protein (Fc Tag)Mouse CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Human TRAILR3 / TNFRSF10C Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Mouse Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)
Fondo

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD70 on lymphocytes and dendritic cells. The CD27-CD70 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.

Referencias
  • Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.
  • Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.
  • Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.
  • Size / Price
    Catálogo: MG50110-NH
    Precio de lista:   (Save )
    Precio:      [How to order]
    DisponibilidadIn StockInstrucciones de envío
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"