Pedido rápido

Ratón CD4 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CD4 Información de producto de clon de cDNA
Tamaño de cDNA:1374bp
Descripción de cDNA:Full length Clone DNA of Mus musculus CD4 antigen with N terminal His tag.
Sinónimo de gen:L3T4, Ly-4
Sitio de restricción:HindIII + XbaI (6kb + 1.39kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CD4 Gene Plasmid Map
Mouse CD4 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

T-cell surface glycoprotein CD4,  is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. CD4 is a glycoprotein expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells. The CD4 surface determinant, previously associated as a phenotypic marker for helper/inducer subsets of T lymphocytes, has now been critically identified as the binding/entry protein for human immunodeficiency viruses (HIV). The human CD4 molecule is readily detectable on monocytes, T lymphocytes, and brain tissues. All human tissue sources of CD4 bind radiolabeled gp120 to the same relative degree; however, the murine homologous protein, L3T4, does not bind the HIV envelope protein. CD4 is a co-receptor that assists the T cell receptor (TCR) to activate its T cell following an interaction with an antigen presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR. CD4 interacts directly with MHC class II molecules on the surface of the antigen presenting cell via its extracellular domain. The CD4 molecule is currently the object of intense interest and investigation both because of its role in normal T-cell function, and because of its role in HIV infection. CD4 is a primary receptor used by HIV-1 to gain entry into host T cells. HIV infection leads to a progressive reduction of the number of T cells possessing CD4 receptors.

Viral protein U (VpU) of HIV-1 plays an important role in downregulation of the main HIV-1 receptor CD4 from the surface of infected cells. Physical binding of VpU to newly synthesized CD4 in the endoplasmic reticulum is an early step in a pathway leading to proteasomal degradation of CD4. Amino acids in both helices found in the cytoplasmic region of VpU in membrane-mimicking detergent micelles experience chemical shift perturbations upon binding to CD4, whereas amino acids between the two helices and at the C-terminus of VpU show no or only small changes, respectively. Paramagnetic spin labels were attached at three sequence positions of a CD4 peptide comprising the transmembrane and cytosolic domains of the receptor. VpU binds to a membrane-proximal region in the cytoplasmic domain of CD4.

  • Farrar WL, et al. (1988) Characterization of CD4 glycoprotein determinant-HIV envelope protein interactions: perspectives for analog and vaccine development. Crit Rev Immunol. 8(4): 315-39.
  • Biddison WE, et al. (1989) CD4 expression and function in HLA class II-specific T cells. Immunol Rev. 109: 5-15.
  • Singh SK, et al. (2012) Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy. FEBS J. 279(19):3705-14.
  • Size / Price
    Catálogo: MG50134-NH
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.