Pedido rápido

Text Size:AAA

Ratón CD69 / CLEC2C clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse CD69 Información de producto de clon de cDNA
Tamaño de cDNA:600bp
Descripción de cDNA:Full length Clone DNA of Mus musculus CD69 antigen with N terminal His tag.
Sinónimo de gen:AIM, VEA, AI452015, 5830438K24Rik, Cd69
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Early activation antigen CD69, also known as activation inducer molecule (AIM), is a single-pass type II membrane protein. Recently, cDNA clones encoding human and mouse CD69 were isolated and showed CD69 to be a member of the C-type lectin superfamily. It is one of the earliest cell surface antigens expressed by T cells following activation. Once expressed, CD69 acts as a costimulatory molecule for T cell activation and proliferation. In addition to mature T cells, CD69 is inducibly expressed by immature thymocytes, B cells, natural killer (NK) cells, monocytes, neutrophils and eosinophils, and is constitutively expressed by mature thymocytes and platelets. CD69 is involved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, natural killer (NK) cells, and platelets. The structure, chromosomal localization, expression and function of CD69 suggest that it is likely a pleiotropic immune regulator , potentially important in the activation and differentiation of a wide variety of hematopoietic cells. This membrane molecule transiently expresses on activated lymphocytes, and its selective expression in inflammatory infiltrates suggests that it plays a role in the pathogenesis of inflammatory diseases. CD69 plays a crucial role in the pathogenesis of allergen-induced eosinophilic airway inflammation and hyperresponsiveness and that CD69 could be a possible therapeutic target for asthmatic patients.

  • Ziegler SF, et al. (1994) The activation antigen CD69. Stem Cells. 12(5): 456-65.
  • Marzio R, et al. (1999) CD69 and regulation of the immune function. Immunopharmacol Immunotoxicol. 21(3): 565-82.
  • Lamana A, et al. (2006) The role of CD69 in acute neutrophil-mediated inflammation. Eur J Immunol. 36(10): 2632-8.
  • Miki-Hosokawa T, et al. (2009) CD69 controls the pathogenesis of allergic airway inflammation. J Immunol. 183(12): 8203-15.
  • Size / Price
    Catálogo: MG50731-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.