CEL cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

CEL cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1800 bp
Description
Full length Clone DNA of Mouse BAL; 1810036E18Rik; Cel with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CEL cDNA ORF Clone, Mouse, N-His tag: Alternative Names

1810036E18Rik cDNA ORF Clone, Mouse; BAL cDNA ORF Clone, Mouse

CEL Background Information

CEL-maturity onset diabetes of the young (MODY), diabetes with pancreatic lipomatosis and exocrine dysfunction, is due to dominant frameshift mutations in the acinar cell carboxyl ester lipase gene (CEL). Bile-salt activated carboxylic ester lipase (CEL) is a major triglyceride, cholesterol ester and vitamin ester hydrolytic enzyme contained within pancreatic and lactating mammary gland secretions. Carboxyl ester lipase is a digestive pancreatic enzyme encoded by the CEL gene. Mutations in CEL cause maturity-onset diabetes of the young as well as pancreatic exocrine dysfunction. The enzyme carboxyl ester lipase (CEL), also known as bile salt-dependent or -stimulated lipase (BSDL, BSSL), hydrolyzes dietary fat, cholesteryl esters and fat-soluble vitamins in the duodenum. CEL is mainly expressed in pancreatic acinar cells and lactating mammary glands. The human CEL gene resides on chromosome 9q34.3 and contains a variable number of tandem repeats (VNTR) region that encodes a mucin-like protein tail.
Full Name
carboxyl ester lipase

CEL cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait